 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | aroC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| aroC | - | 2412706..2413473 | COG0710E | aroF-BAC-1 aroF-STA |
| Operon evidence: | Northern blotting (0.9 kb transcript); downstream gene is on the opposite strand |
|---|---|
| Reference: | Azevedo V, et al. (1993), Genbank L09228 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACTCAAGCTATATAGCTTGAGTTTTTTTAATTATGG >>>>>>>> <<<<<<<< |
aroC |
|