| Regulated Operon: | atp |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| atpI | - | 3787620..3788003 | ||||
| atpB | - | 3786878..3787612 | COG0356C | atpB-STA atpB-STR | ||
| atpE | - | 3786620..3786832 | COG0636C | atpE-BAC atpE-STA | ||
| atpF | - | 3785945..3786457 | COG0711C | atpF-STA atpF-STR | ||
| atpH | - | 3785403..3785948 | COG0712C | |||
| atpA | - | 3783878..3785386 | COG0056C | atpA-LAB atpA-STA atpA-STR atpC-STR | ||
| atpG | - | 3782938..3783801 | COG0224C | atpB-STR atpG-STA atpG-STR | ||
| atpD | - | 3781491..3782912 | COG0055C | atpA-STR atpD-BAC atpD-LAB atpD-MYC atpD-STA atpD-STR | ||
| atpC | - | 3781069..3781467 | COG0355C | atpC-BAC atpC-STA atpC-STR atpG-STR |
| Operon evidence: | Genome analysis; downstream gene is on the opposite strand |
|---|---|
| Reference: | Presecan E, et al. (1997) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAATCCTTCTCTTTATGAGAAGGATTTTTTTATGAACGC >>>>>>>> <<<<<<<< |
atpC |


|