| Regulated Operon: | fbaA-ywjH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| fbaA | fba | - | 3808512..3809369 | COG0191G | fbaA-BAC fbaA-STA fba-MYC | |
| ywjH | - | 3807754..3808392 | COG0176G | ywjH-BAC |
| Operon evidence: | Northern blotting (1.7 kb transcript) |
|---|---|
| Reference: | Trach K, et al. (1988), Ludwig H, et al. (2001) |
| Comments: | The readthrough terminator downstream of fbaA leads to a 1.0 kb transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATGAAAGGGGCGGCAAACAGCTTTATGCCTGTTTGCCGCGGCCTTTGTATTTCACCGAC >>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<< |
ywjH | |||
| TTTTATAGCCGCCTGACAGCTTGACAGGCGGTTTTCCGTCTATCTT >>>>>>>>>> <<<<<<<<<< |
fbaA |


|