 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | gcvT-gcvPA-gcvPB |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| gcvT | yqhI | - | 2548245..2549333 | COG0404E | gcvT-BAC gcvT-STA | |
| gcvPA | gcvP | - | 2546869..2548215 | COG0403E | gcvPA-BAC | |
| gcvPB | gcvP | - | 2545410..2546876 | COG1003E |
| Operon evidence: | Northern blotting (4.2 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2003) |
| Comments: | A potential readthrough terminator was found downstream of gcvPA (2.5 kb transcript). An internal promoter may exist upstream of gcvPA (2.8 kb transcript). |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACAGCTGTCTACCAGACAGCTGTTTGCTTTATTTCTT >>>>>>>>> <<<<<<<<< |
gcvPB |
|