 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | mtlR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| mtlR | ydaA | + | 467130..469214 | COG3711K |
| Operon evidence: | Northern blotting (2.1 kb transcript) |
|---|---|
| Reference: | Watanabe S, et al. (2003) |
| Comments: | Northern blotting results in BSORF show a ycsN and a ycsN-mtlR transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CATGGCACACGTCAAAAATTTGGCGTGTGTTTTTCTGTGGATGG >>>>>>>>>> <<<<<<<<<< |
mtlR |
|