 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | pheBA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| pheB | - | 2852157..2852600 | COG4492R | |||
| pheA | - | 2851283..2852140 | COG0077E |
| Operon evidence: | S1 protection |
|---|---|
| Reference: | Trach K & Hoch JA (1989), Sun D & Setlow P (1993) |
| Comments: | S1 protection assay showed that pheB and pheA belong to the same operon, but did not fix the location of the terminator. Internal promoter in front of pheA. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCCCACTAGAGGGCTTTTTTTAGTCTTTA >>>> <<<< |
pheA |
|