 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | xylR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| xylR | - | 1890512..1891564 | COG1940KG |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Hastrup S: Genetics and Biotechnology of Bacilli Vol. 2: pp. 79-83 (1988) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GACAGCTCATCTTTAAAGATGAGTTTTTTTATTCTAGG >>>>>>> <<<<<<< |
xylR |
|