| Regulated Operon: | ybxG |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ybxG | ybdP | + | 226566..227954 | COG1113E |
| Operon evidence: | Genome analysis |
|---|---|
| Reference: | Shcheptov M, et al. (1997) |
| Comments: | The Northern blotting analysis listed in BSORF shows a 2.0 kb transcript, which corresponds to a ybxG-csgA-ybxH transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGAGACATTCACGGATGTCTCTTTTTTTATTTTTCG >>>>>>>> <<<<<<<< |
ybxG |


|