 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ycbCDEFGHJ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ycbC | + | 267890..268816 | COG0329EM | ycbC-BAC | ||
| ycbD | + | 268846..270312 | COG1012C | ycbD-BAC | ||
| ycbE | + | 270387..271754 | ||||
| ycbF | + | 271791..273158 | ||||
| ycbG | + | 273237..273938 | COG2186K | |||
| ycbH | + | 274020..275552 | ||||
| ycbJ | + | 275838..276758 | COG3173R |
| Operon evidence: | Northern blotting (8.3 kb transcript) |
|---|---|
| Reference: | Hosoya S, et al. (2002) |
| Comments: | Internal promoter in front of ycbG, leading to a 2.3 kb ybcGH transcript. Measured mRNA transcripts suggest that readthrough terminators may exist behind ycbG and ycbH, leading to a 5.9 kb ybcCDEFG transcript, a 0.8 kb ybcG transcript, a 7.4 ybcCDEFGH transcript, and a 2.3 kb ybcGH transcript. Northern blotting results in BSORF various transcripts in this region. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CGAGACCCTCGTCCTTTGCATAGGACGGGGGTTTTTTGTGTTTCTT >>>>>>>>>> <<<<<<<<<< |
ycbJ |
|