 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ycbR |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ycbR | + | 283003..283734 |
| Operon evidence: | Northern blotting (1.2 kb and 1.4 kb transcripts) |
|---|---|
| Reference: | BSORF |
| Comments: | ycbR is shown as a monocistronic transcript in BSORF, however the indicated transcript lengths are not consistent with the 729 bp length of ycbR. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAGAGCACTGAGTCATTCTGCGAAATGGCTCGGTGTTTTTGTTTTTTT >>>>>>>>>>>> <<<<<<<<<<<< |
ycbR |
|