 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yfkABC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yfkA | - | 868007..869128 | COG0535R | |||
| yfkB | - | 867343..867804 | ||||
| yfkC | - | 867164..868006 | COG0668M |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF, Genbank D83967 |
| Comments: | Northern blotting results in BSORF suggest that an internal promoter exists in front of yfkB. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACTGATTCCGAGTTGGAATCAGTTTTTTATTTATCTT >>>>>>>> <<<<<<<< |
yfkB |
|