| Regulated Operon: | ypuGHI |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ypuG | - | 2425831..2426586 | COG1354S | |||
| ypuH | - | 2424442..2425035 | ||||
| ypuI | - | 2424654..2425193 |
| Operon evidence: | Northern blotting (2.0 kb transcript) |
|---|---|
| Reference: | Azevedo V, et al. (1993), Buchanan CE & Ling ML (1992) |
| Comments: | Internal promoter in front of ypuI, leading to a 0.5 kb transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GTTTACTCTCCCTTTTTCAGGGAGAGTTTTTTTATGTTTGC >>>>>>>> <<<<<<<< |
ypuH |


|