 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yqjHI |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yqjH | - | 2482269..2483513 | COG0389L | |||
| yqjI | - | 2480750..2482159 | COG0362G | gnd-BAC |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the existence of an internal promoter in front of yqjI |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AGAAACCCCCGAAGCTCTTAAGCTTTGGGGGTTTTGTTATTAAGGA >>>>>>>>>>> <<<<<<<<<<< |
yqjI |
|