 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yqjK |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yqjK | - | 2478006..2478929 | COG1234R | yqjK-BAC |
| Operon evidence: | Northern blotting; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | BSORF |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAAAGACCGGGAATCCCTTACGGCCCGGTCTTTTTTTACGTTAAT >>>>>>>>>>>> <<<<<<<<< |
yqjK |
|