| Regulated Operon: | yqjYZ-yqkABC |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yqjY | - | 2463571..2464041 | COG0456R | |||
| yqjZ | - | 2463217..2463561 | COG2329R | |||
| yqkA | - | 2462193..2463224 | COG2320S | x0490-BAC yqkA-BAC | ||
| yqkB | - | 2461873..2462196 | COG4918S | |||
| yqkC | - | 2461621..2461860 |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the existence of internal promoters in front of yqkB and yqkC |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCGAAAGAGCCGAAGAGGCCTTTCGCTTTTTTATTCTGTTG >>>>>>>>>>> <<<<<<<<<< |
yqkC |


|