 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ytjP |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ytjP | - | 3067420..3068811 | COG0624E |
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Lapidus A, et al. (1997), Genbank AF008220 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAAAAGGACCGGCTTCTGCTGAAGCCAGTCCTTTTTTTAAATAAAT >>>>>>>>>>> <<<<<<<<<<< |
ytjP |
|