 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yulF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yulF | + | 3196906..3197892 | COG0673R |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Oudega B, et al. (1997), Genbank Z93938 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAATCCGCCCGCGTGCAAATGCCGCGGCGGATTTTTTATTAGACAA >>>>>>>>>>>>> <<<<<<<<<<< |
yulF |
|