 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | ywdH |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ywdH | ipa-58r | + | 3896290..3897660 | COG1012C | x0897-BAC |
| Operon evidence: | Genome analysis; upstream and downstream genes are on the opposite strand |
|---|---|
| Reference: | Presecan E, et al. (1997) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAAGCGCAGATCACCTGCGCTTTTTACAAATCCTT >>>>>> <<<<<< |
ywdH |
|