| Regulated Operon: | ywpE |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| ywpE | - | 3741732..3742040 | COG3764M |
| Operon evidence: | Genome analysis; upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Presecan E, et al. (1997), Genbank Z83337 |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| GAAAAGCTGCCGTTCAAAACGGCAGCTTTTTTCATGCAGAA >>>>>>>>> <<<<<<<<< |
ywpE |


|