 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yxbF |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxbF | yxaT | - | 4092695..4093837 | COG1309K |
| Operon evidence: | Northern blotting (1.3 kb transcript); upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ACAAAAAGAGAGGGGGCTCCCTCTCTTATTTCGTTTCTTCCTT >>>>>>>>> <<<<<<<<< |
yxbF |
|