 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yxiM-deaD |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxiM | - | 4017508..4018656 | COG3401R | |||
| deaD | yxiN | - | 4015987..4017426 | COG0513LKJ | x0363-BAC ydbR-BAC |
| Operon evidence: | Northern blotting (2.7 kb transcript); downstream genes are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000) |
| Comments: | Internal promoter in front of deaD, leading to a 1.6 kb transcript. A short (500 bp) transcript was found at the beginning of yxiM. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ATGAATGACCTGCTCCCAGTTAAAGGGGCAGGTCATTTTGCTGCTGGCTG >>>>>>>>>>> <<<<<<<<<<< |
deaD |
|