| Regulated Operon: | yxiT |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxiT | - | 4006434..4006676 |
| Operon evidence: | Northern blotting (0.8 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2000) |
| Comments: | The genome sequence between yxiT and the indicated terminator contains an ORF homologous to Bacillus licheniformis BL05383, yjeAA (BL00500), and Clostridium perfrigens gene CPE2311. Another potential terminator is located 250 base-pairs downstream of the yxiT stop codon. The indicated terminator agrees better with the Northern blotting result. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| CAATAATGAAAAGAGCCATATCCGAAAAGGGATATGGCTCAATGTTTCTACCACACA >>>>>>>>>>> <<<<<<<<<<< |
yxiT |


|