 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yxjA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxjA | nupG | + | 4005752..4006945 | COG1972F |
| Operon evidence: | Northern blotting (1.3 kb transcript) |
|---|---|
| Reference: | Yoshida K, et al. (2000), BSORF |
| Comments: | The Northern blotting results in BSORF show a 1.5 kb and a 2.5 kb transcript. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| ACATTGAGCCATATCCCTTTTCGGATATGGCTCTTTTCATTATTGATA >>>>>>>>>>> <<<<<<<<<<< |
yxjA |
|