 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yxnA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yxnA | + | 4108058..4109128 | COG0300R |
| Operon evidence: | Northern blotting (1.1 kb transcript); upstream and downstream gene are on the opposite strand |
|---|---|
| Reference: | Yoshida K, et al. (2000) |
| Comments: |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAACCCATGCTGTTCCAGCGAACCATGGGTTTTTCAGCTGTTAA >>>>>>>>>>>> <<<<<<<<<< |
yxnA |
|