 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yybNMLKJ |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yybN | + | 4173114..4173551 | ||||
| yybM | + | 4173665..4174420 | ||||
| yybL | + | 4174410..4175120 | ||||
| yybK | + | 4175117..4175872 | ||||
| yybJ | + | 4175869..4176525 | COG1131V |
| Operon evidence: | Northern blotting |
|---|---|
| Reference: | BSORF |
| Comments: | Northern blotting results in BSORF suggest the existence of readthrough terminators after yybN and yybM. |
| Binding factor |
Regulation | Location | Absolute position | Binding seq.(cis-element) | Experimental evidence |
|---|---|---|---|---|---|
| Rok | Negative | ND | ND | ND |
Albano M, et al. (2005): RG AR DB GS |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| TAGAATGATAATCTTTTTATAAGATTATCATTTTTATTTATTCTA >>>>>>>>>> <<<<<<<<<< |
yybN |
|