 |
Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai |
| Regulated Operon: | yycFGHIJ-yyxA |
| Genes | Synonyms | Direction | Genome position | Function | COG ID | Conserved groups |
|---|---|---|---|---|---|---|
| yycF | - | 4152719..4153426 | yycF-BAC | |||
| yycG | - | 4150876..4152711 | vicK-STA | |||
| yycH | - | 4149519..4150886 | ||||
| yycI | - | 4149667..4150509 | COG4853S | |||
| yycJ | - | 4148851..4149645 | COG1235R | yycJ-BAC | ||
| yyxA | yycK, yycK | - | 4146591..4147793 |
| Operon evidence: | Northern blotting (7.4 kb transcript); transcriptional fusions |
|---|---|
| Reference: | Fabret C & Hoch JA (1998), Fukuchi K, et al. (2000), BSORF |
| Comments: | Internal promoter in front of yyxA, leading to a 1.4 kb transcript. A shorter (2.4 kb) yycFG transcript was also detected. |
| Terminator sequence | Absolute position | Position from stop codon | Free energy [kcal/mol] |
Downstream of |
|---|---|---|---|---|
| AAAAGCAGTCTGGCATCGTTGCCAGGCTGTTTTGATATGCAAAA >>>>>>>>>> <<<<<<<<<< |
yyxA |
|