Transcription factor: AbrB

Factor type AbrB-SpoVT
SWISS-PROT ND
SubtiList ND
Consensus seq. WAWWTTTWCAAAAAAW, TGGNA
Comment Bi-functional; expressed during the transition state between vegetative growth and the onset of stationary phase and sporulation; acts as the Spo0A-AbrB circuit; also involved in catabolite repression.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
abrB abrB SigA Negative 45221..45250 -43:-14; -29:+1 CAAAATGATTGACGATTATTGGAAACCTTG Strauch MA, et al. (1989): GS FT
aprE aprE SigA Negative 1105609..1105685 -59:+18 AAAATCATCTCAAAAAAATGGGTCTACTAAAATATTATTCCATCTATTACAATAAATTCACAGAATAGTCTTTTAAG Ferrari E, et al. (1986): DB RG
Ferrari E, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.39-44: DP NB
Strauch MA, et al. (1989): GS FT
Ogura M, et al. (2003): DB RG
argCJBD-carAB-argF argC SigA Positive ND ND ND O'Reilly M, et al. (1994): RG
citB citB SigA Positive 1926577..1926625 -35:+14 TTTACTTATGTATGATTTTGTTTTAATATGAAATTGTGAGAAAATTGTG Kim HJ, et al. (2003): RG FT
comK comK SigA Negative 1116992..1117111 -81:+39 CATTAAATATCATTAAAAGATGATTTTATCTTAAATGTTAAAAAAACCTGTCGTTTTACAAAAACAGATGATAGATTATTAGTATAAATTTTGCAGAAAAAGGATGGAGGCCATAATATG Hamoen LW, et al. (2003): FT
Hahn J, et al. (1994): DB
dppABCDE dppA SigA Negative 1360349..1360382 -16:+18 TTTAATATAATTTGTTAGAATATTCATAATTTAG Slack FJ, et al. (1991): FT DB
yrhIJ yrhI None Negative ND ND ND Gustafsson MC, et al. (2001): RG
sdpRI yvbA SigA Negative ND ND ND Ellermeier CD, et al. (2006): DB RG
ftsAZ ftsA None Negative 1596335..1596353 -1:+18 AATAAACATAAAATGTGAA Strauch MA, et al. (1995): FT
ftsAZ ftsA None Negative 1596369..1596392 +34:+57 TTCTGTTGTTATTTTTTGTTACAC Strauch MA, et al. (1995): FT
hpr hpr None Positive ND ND ND Strauch MA, et al. (1989): GS
hut hutP SigA Positive 4041649..4041671 +199:+221 CAATTGAAACCGCTTCCAAAAAG Fisher SH, et al. (1994): FT
kinB-kapB kinB SigA Negative 3230005..3230033 -34:-6 TTTTACTTCTAATATTTAGTGTTATAATA Strauch MA, et al. (1995): FT
pbpE-racX pbpE SigW Negative 3535546..3535570 -84:-60 ATGTGATGGGTTAAAAAGGATCTCT Strauch MA, et al. (1995): FT
pbpE-racX pbpE SigW Negative 3535513..3535538 -52:-27 GGATTTTTCAAAATATTTGAAACGTT Strauch MA, et al. (1995): FT
rbsRKDACB rbsR SigA Positive 3701237..3701313 -133:-67 GAAATCTTCATCCATATTTGTGAAGACTTTGTCAAAAAAAGAGTGAAAACCTTAAATTTTTCAATTATATATACAAT Strauch MA, et al. (1995): DB FT
rbsRKDACB rbsR SigA Positive 3701375..3701407 -4:+29 CTATGTAAACGGTTACATAAACAAGGAGGAGCT Strauch MA, et al. (1995): DB FT
rok rok None Negative ND ND ND Hoa TT, et al. (2002): RG DB
sboAX-albABCDEFG sboA SigA Negative ND ND ND Zheng G, et al. (2000): DB
senS senS None Negative ND ND ND McCready P, et al. (1993): DB RG
sigH sigH SigA Negative 116540..116579 -35:+5 TGACGCTTTTTTGCCCAATACTGTATAATATTTCTATCTA Zuber P, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.123-127: DB RG
Strauch MA, et al. (1995): FT
sigW-ybbM sigW SigW Negative 194835..194861 +14:+41 GAGGTTAGATAAATATGGAAATGATGA Qian Q, et al. (2002): RG FT
sinIR sinI SigA Negative 2552347..2552369 +24:+46 TTTAATGGCAAATGACTTCCAGA Strauch MA (1995): GS
Shafikhani SH, et al. (2002): PE FT
Shafikhani SH & Leighton T (2004): DB RG
spo0E spo0E SigA Negative 1430595..1430629 -39:-5 TATGTTTACAAATAAAGTATAATCTGTAATAATGC Strauch MA, et al. (1989): GS FT
spoVG spoVG SigH Negative 55755..55824 -75:-6 TAACTATATCCTATTTTTTCAAAAAATATTTTAAAAACGAGCAGGATTTCAGAAAAAATCGTGGAATTGA Zuber P & Losick R (1983): DB DP RG
Zuber P & Losick R (1987): DB RG RO
Zuber P, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.123-127: DB RG
Furbass R, et al. (1991): GS FT
skf ybcO SigA Negative ND ND ND Fujita M, et al. (2005): RG
ycnK ycnK None Negative ND ND ND Hamon MA, et al. (2004): AR RT-PCR
yknWXYZ yknW SigW Negative 1503496..1503541 -60:-15 GGTTTTTGGAAATTTATTAGAAAAACATGAAACTTTTTGATATCCT Qian Q, et al. (2002): RG FT
yoaW yoaW SigE Negative ND ND ND Hamon MA, et al. (2004): AR RT-PCR
yocH yocH SigA Negative ND ND ND Hamon MA, et al. (2004): AR RT-PCR
sdp yvaW None Negative ND ND ND Fujita M, et al. (2005): RG DB
yvlABCD yvlA SigW Negative 3608884..3608908 -79:-55 TTAAAATCCAATTTCCGTAAATCGG Qian Q, et al. (2002): RG FT
yvqIHGFEC yvqI None Negative 3398956..3399006 -50:+1 AATCAATCTCTGATTCGTTTTGCATATCTTCCAACTTGTATAAGATGAAGA Hamon MA, et al. (2004): AR RT-PCR
Jordan S, et al. (2007): FT,RG
yxaAB yxaA None Negative 4113282..4113329 -68:-21 TTTTTATTTAAATTTTTACCATATTGCATGGTATGTATTTCCAGATCA Nagorska K, et al. (2008): DB RG FT
yxbBA-yxnB-asnH-yxaM yxbB None Negative ND ND ND Hamon MA, et al. (2004): AR RT-PCR
yxbCD yxbC None Negative ND ND ND Hamon MA, et al. (2004): AR RT-PCR
yxzE yxzE SigW Negative 3982930..3982971 -17:+25 TCATCCGTATAACAGATATGGTGAAAAAAGGGAGTGACGCGA Qian Q, et al. (2002): RG FT




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai