Transcription factor: AraR

Factor type LacI family
SWISS-PROT ND
SubtiList ND
Consensus seq. ATTTGTACGTACAAAT
Comment transcriptional regulator (LacI family); negative regulation of the L-arabinose metabolic operon (araABDLMNPQ); alternate gene name: araC, yvbS
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
abnA abnA SigA Negative 2950159..2950187 -48:-20 CTATTTTTTTGTCTGTACAAATTACAGCA Raposo MP, et al. (2004): RG PE SDM
araABDLMNPQ-abfA araA SigA Negative 2948956..2948980 -8:+17 ATAAAATTGTTCGTACAAATATTTA Sa Nogueira & Mota LJ (1997): DB HM
Mota LJ, et al. (1999): FT
araABDLMNPQ-abfA araA SigA Negative 2948915..2948935 +38:+58 CATTAGTACGTATCTTTTGTA Sa Nogueira I & Mota LJ (1997): DB HM
Mota LJ, et al. (1999): FT
araE araE SigA Negative 3485556..3485575 -6:+14 ATATTTGTACGTACTAATTA Sa Nogueira I & Ramos SS (1997): DB HM
Mota LJ, et al. (1999): FT
araE araE SigA Negative 3485510..3485534 +36:+60 TAATATAAGTACGTACAATTGAAGG Sa Nogueira I & Ramos SS (1997): DB HM
Mota LJ, et al. (1999): FT
araR araR SigA Negative 3485637..3485656 -6:+14 AAATTTGTCCGTATACATTT Sa Nogueira I & Mota LJ (1997): DB HM
Mota LJ, et al. (1999): FT
xsa xsa SigA Negative 2915293..2915324 -77:-46 TATAAATACATACGTACAAATATAAAAACAAT Raposo MP, et al. (2004): RG PE FT
xsa xsa SigA Negative 2915254..2915285 -38:-7 GTCGTTGACATGTACGAACATATATAATATGG Raposo MP, et al. (2004): RG PE FT




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai