Transcription factor: BkdR

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. TGCAAATGAAGGCA(forward), TGCAATAATTTGCA(forward), TGCAGATGTTTGCG(reverse)(plausible)
Comment None
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
ptb-bcd-buk-lpdV-bkdAABB ptb SigL Positive 2504787..2504820 -128:-95 AATATGGCCTTGCAAATGAAGGCATGCAATAATT Debarbouille M, et al. (1999): DB
ptb-bcd-buk-lpdV-bkdAABB ptb SigL Positive 2504773..2504806 -114:-81 AATGAAGGCATGCAATAATTTGCAGAATAAACGC Debarbouille M, et al. (1999): DB
ptb-bcd-buk-lpdV-bkdAABB ptb SigL Positive 2504752..2504785 -93:-60 GCAGAATAAACGCAAACATCTGCACGAATGTTTC Debarbouille M, et al. (1999): DB




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai