Transcription factor: BmrR

Factor type ND
SubtiList ND
Consensus seq. ND
Comment a similar factor, BltR, regulates another multidrug transporter operon, Blt; the binding activity is enhanced by rhodamine and tetraphenylphosphonium (TPP)
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
bmrU-bmr-bmrR bmr SigA Positive 2494591..2494621 -37:-7 TTGACTCTCCCCTAGGAGGAGGTCTTACAGT Ahmed M, et al. (1994): DB GS FT

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai