Transcription factor: CodY

Factor type Unique (MITOCH-CARRIER)
SWISS-PROT ND
SubtiList ND
Consensus seq. No consensus seq has been deduced: A+T rich stretch?
Comment transcriptional regulator; negative regulation of srfA and comK genes (in the presence of casamino-acids), dpp operon
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
acsA acsA SigA Negative ND ND ND Fisher SH (1999): Unpublished data
citB citB SigA Negative ND ND ND Kim HJ, et al. (2002): RG FT
citB citB SigA Negative ND ND ND Kim HJ, et al. (2002): RG FT
comK comK SigA Negative 1116996..1117060 -77:-13 AAATATCATTAAAAGATGATTTTATCTTAAATGTTAAAAAAACCTGTCGTTTTACAAAAACAGAT Serror P, et al. (1996): DB FT GS
dppABCDE dppA SigA Negative 1360358..1360395 -7:+31 ATTTGTTAGAATATTCATAATTTAGTAAAAAAGGAGGA Serror P, et al. (1996): GS FT
gabP gabP SigA Negative ND ND ND Ferson AE, et al. (1996): DB DP
hag hag SigD Negative 3635865..3635924 +70:+129 CATATTCAGGGAGGAACAAAACAATGAGAATTAACCACAATATTGCAGCGCTTAACACAC Bergara F, et al. (2003): DB RG GS FT
hut hutP SigA Negative 4041448..4041473 -3:+23 CTCAGTTAATAGTTATCAGAATTTTT Fisher SH, et al. (1996): DB DP
ilvA-ypmP ilvA None Negative ND ND ND Molle V, et al. (2003): AR
Mader U, et al. (2004): NB
ilvBHC-leuABCD ilvB SigA Negative 2897454..2897653 -199:+1 TCTTCCATGTTTATATAAAATTAAATAATTCTGGTGTATTCTTGATAGATTAATAAAAAAATTATAAAAACTTTTAACATTTGCAATTCCTTTTGTACCAATAATGAAAGCGTATACAATATAGATTGATTAATCAAAATTGTCTAATAATTTTAAAAAATGCTGTTGACACTGCGTCCAAAGCGGCGTAATATGAGTTC Molle V, et al. (2003): CH RG GS
Mader U, et al. (2004): NB
Shivers RP, et al. (2004): FT
ilvD ilvD None Negative ND ND ND Molle V, et al. (2003): CH RG GS
Mader U, et al. (2004): NB
ptb-bcd-buk-lpdV-bkdAABB ptb SigL Negative ND ND ND Debarbouille M, et al. (1999): RG
rapC-phrC rapC SigA Negative ND ND ND Lazazzera BA, et al. (1999): RG
srfAA-srfAB-comS-srfAC-srfAD srfAA SigA Negative 376640..376726 -38:+49 CGGTGATAAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTT Wray LV Jr, et al. (1996): DB FT GS
ureABC ureA SigA Negative ND ND ND Debarbouille M, et al. (1997): DP DB
ybgE ybgE None Negative ND ND ND Molle V, et al. (2003): CH RG GS
Mader U, et al. (2004): NB
yhdG yhdG sigA Negative 1023160..1023195 -64:-28 AATTTGTCGATTTTTCTAACAATTTTGTTTTCATTT Belitsky BR, et al. (2011): GS FP RG
yhdG yhdG SigA Negative 1023284..1023317 +62:+95 GTTACTCATGAATTCAGAAAATTCAAATAAAATA Belitsky BR, et al. (2011): FP RG GS




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai