Transcription factor: ComA

Factor type LuxR/UhpA family
SWISS-PROT ND
SubtiList ND
Consensus seq. TTGCGGNNNNCCGCAA----------TTGCNNNNATTT
Comment positive regulator of genes involved in late-growth expression and in response to environmental stress; is phosphorylated by ComP; may cause DNA bending by bridging two binding sites
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
degQ degQ SigA Positive 3257339..3257381 -74:-32 AGATTTGCGGTGTCACGCAGGACTTTTTTGCATACTTTTCGGT Msadek T, et al. (1991): DP DB RG
pel pel None Positive 827869..827884 None TTGCAGAATGCCGCAA Comella N & Grossman AD (2005): DB AR OV RG
rapA-phrA rapA SigA Positive 1315763..1315802 -75:-36 TTGCGGTTAGCCGAAATTCGACAATTGCGGTTATTTTGCG Mueller JP, et al. (1992): DP RO DB
rapC-phrC rapC SigA Positive 428727..428805 -72:+7 TTGCGTGCTCCCGAAAACAAAGATTGCGTGTTTTTCGGGTTGGGACGGCCTATAAACATGATAAAATATGACATAAACA Lazazzera BA, et al. (1999): DP HM PE
Bongiorni C, et al. (2005): GS
rapE-phrE rapE None Positive ND ND ND Jiang M, et al. (2000): RG
rapF-phrF rapF None Positive ND ND ND Bongiorni C, et al. (2005): RG DB
srfAA-srfAB-comS-srfAC-srfAD srfAA SigA Positive 376560..376597 -118:-81 TTGCGGCATCCCGCAAAAAATATTGCTGTAAATAAACT Hahn J & Dubnau D (1991): DB RG
Nakano MM, et al. (1991): DP SDM
Roggiani M & Dubnau D (1993): GS FT
srfAA-srfAB-comS-srfAC-srfAD srfAA SigA Positive 376604..376641 -74:-37 TTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCG Hahn J & Dubnau D (1991): DB RG
Nakano MM, et al. (1991): DP SDM
Roggiani M & Dubnau D (1993): GS FT




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai