Transcription factor: ComK

Factor type Unique (CTF)
SWISS-PROT ND
SubtiList ND
Consensus seq. AAAANNNNNTTTT
Comment Positive autoregulatory gene occupying a central position in the competence-signal-transduction network; CTF = competence transcription factor. Typically, more than one ComK binding site is found in each promoter, with distances of 8, 18, or 31 basepairs between them.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
addBA addB SigA Positive 1136202..1136225 -90:-67 TGCGGAGATAATCAGCTTTTTATA Haijema BJ, et al. (1995): DB OV RG DP GS
Hamoen LW, et al. (1998): FT
addBA addB SigA Positive 1136225..1136251 -67:-41 ATGTGAAAAGGCCGTTTTTACCAATAG Haijema BJ, et al. (1995): DB OV RG DP GS
Hamoen LW, et al. (1998): FT
bdbDC bdbD SigE Positive ND ND ND Meima R, et al. (2002): RG
comC comC SigA Positive 2865265..2865294 -94:-65 AGAATCAAAAAAAGATTCTGCCGTTTTTTT Guillen N, et al. (1989): DB RG
Van Sinderen D, et al. (1994): DB RG
Van Sinderen D, et al. (1995): GS
Hamoen LW, et al. (1998): FT
comC comC SigA Positive 2865236..2865265 -65:-36 TCATGTGTAAAATTGAATATTCCCAATTGG Guillen N, et al. (1989): DB RG
Van Sinderen D, et al. (1994): DB RG
Van Sinderen D, et al. (1995): GS
Hamoen LW, et al. (1998): FT
comEABC comEA SigA Positive 2642093..2642117 -82:-58 AAACCATCGTTTCCTAAAACGATGG Guillen N, et al. (1989): DB RG
Van Sinderen D, et al. (1994): DB RG
Van Sinderen D, et al. (1995): GS
Hamoen LW, et al. (1998): FT
comEABC comEA SigA Positive 2642065..2642093 -58:-32 GTTTTTTAAAATGCTTTTTTATGCTTTTG Guillen N, et al. (1989): DB RG
Van Sinderen D, et al. (1994): DB RG
Van Sinderen D, et al. (1995): GS
Hamoen LW, et al. (1998): FT
comFABC-yvyF-flgM-yvyG-flgKL comFA SigA Positive 3643638..3643667 -92:-63 ATAAGGCCAAATCTCCGTTTTTAGAGCGGA Londono-Vallejo JA, et al. (1993): DB RG
Van Sinderen D, et al. (1995): GS RG OV
Hamoen LW, et al. (1998): FT
Liu J & Zuber P (1998): DB
Ogura M, et al. (2002): AR RG DB
comFABC-yvyF-flgM-yvyG-flgKL comFA SigA Positive 3643608..3643638 -63:-33 AGATTTTTTTATATTCTTATTTTAATAGTTG Londono-Vallejo JA, et al. (1993): DB RG
Van Sinderen D, et al. (1995): GS RG OV
Hamoen LW, et al. (1998): FT
Liu J & Zuber P (1998): DB
Ogura M, et al. (2002): AR RG DB
comGABCDEFG-yqzE comGA SigA Positive 2560165..2560200 -104:-69 TCTTTTTTCTTGCCAGAAAGAATTGGTTTTTCAGCA Guillen N, et al. (1989): DB RG
Roggiani M, et al. (1990): RG DB
Kong L, et al. (1993): RG DB
Kong L & Dubnau D (1994): RG DB
Van Sinderen D, et al. (1994): DB RG
Van Sinderen D, et al. (1995): GS RG OV
Msadek T, et al. (1995): Two-Component Signal Transduction, pp. 447-471: DB RG
Hahn J, et al. (1996): DB OV RG
Hamoen LW, et al. (1998): FT
Berka RM, et al. (2002): AR HM
comGABCDEFG-yqzE comGA SigA Positive 2560128..2560165 -69:-32 ATATAACATCTCACAAAATCACGTTTTCCCTGTTTGAT Guillen N, et al. (1989): DB RG
Roggiani M, et al. (1990): RG DB
Kong L, et al. (1993): RG DB
Kong L & Dubnau D (1994): RG DB
Van Sinderen D, et al. (1994): DB RG
Van Sinderen D, et al. (1995): GS RG OV
Msadek T, et al. (1995): Two-Component Signal Transduction, pp. 447-471: DB RG
Hahn J, et al. (1996): DB OV RG
Hamoen LW, et al. (1998): FT
Berka RM, et al. (2002): AR HM
comK comK SigA Positive 1116955..1116990 -118:-83 TGAAAGTAAAATCGGTTTATTACTAGTCATTTAGTA Van Sinderen D & Venema G (1994): RG OV DB; Western blot
Van Sinderen D, et al. (1995): GS
Hamoen LW, et al. (1998): FT
Berka RM, et al. (2002): AR HM
comK comK SigA Positive 1116990..1117018 -83:-55 ACCATTAAATATCATTAAAAGATGATTTT Van Sinderen D & Venema G (1994): RG OV DB; Western blot
Van Sinderen D, et al. (1995): GS
Hamoen LW, et al. (1998): FT
Berka RM, et al. (2002): AR HM
cspB cspB SigA Unknown 984174..984207 Downstream of cspB AAAAAGCTGTTTTGCATAAGCAAAACAGCTTTTT Hamoen LW, et al. (1998): GS DP
degR degR SigD Negative ND ND ND Ogura M & Tanaka T (1996): DB RG
Ogura M, et al. (1997): DB DP
nucA-nin nucA None Positive 372710..372739 None CGTATTTTGCTGAAAACAAATATTTCGATC Van Sinderen D, et al. (1995): RG DB GS
nucA-nin nucA None Positive 372686..372710 None CTGCTAAAATTACGATTTCTGCAAT Van Sinderen D, et al. (1995): RG DB GS
rapH-phrH rapH SigA Positive 750853..750886 -75:-42 AAAAAACAAATTGACAGGATGAAAAAACAATTTC Ogura M, et al. (2002): AR RG HM DB
Hayashi K, et al. (2006): RG DB
recA recA SigA Positive 1764463..1764483 -150:-130 GCAAAAATAATATTTTCAGCA Hamoen LW, et al. (2001): FT GS
Haijema BJ, et al. (1996): FT GS RG DB DP
Cheo DL, et al. (1992): DP RG
recA recA SigA Positive 1764493..1764518 -120:-95 CCTAAGAAAACATGATTTCTCTGATA Hamoen LW, et al. (2001): FT GS
Haijema BJ, et al. (1996): FT GS RG DB DP
Cheo DL, et al. (1992): DP RG
recA recA SigA Positive 1764518..1764538 -95:-75 ACATTATGATATTTTGATAGG Hamoen LW, et al. (2001): FT GS
Haijema BJ, et al. (1996): FT GS RG DB DP
Cheo DL, et al. (1992): DP RG
recA recA SigA Positive 1764550..1764570 -65:-35 GAAAAAATCCGAATATGCGTT Hamoen LW, et al. (2001): FT GS
Haijema BJ, et al. (1996): FT GS RG DB DP
Cheo DL, et al. (1992): DP RG
rok rok None Negative 1493641..1493661 None TGAAAAATAAAACATTTTCAG Hoa TT, et al. (2002): GS RG DB
rok rok None Negative 1493661..1493677 None GAAAATAAGGAATTTTT Hoa TT, et al. (2002): GS RG DB
sbcD-yirY-yisB sbcD None Positive ND ND ND Ogura M, et al. (2002): AR RG DB
smf smf None Positive 1682487..1682503 None AAGAACTTGTTCGAAAC Ogura M, et al. (2002): AR RG HM DB
smf smf None Positive 1682503..1682520 None CTTGTAAAACGCATTAAT Ogura M, et al. (2002): AR RG HM DB
thdF-gidAB-yyaA thdF None Positive 4212948..4212969 None CAAACTATGTTATCTTTTAGTT Ogura M, et al. (2002): AR RG HM DB
thdF-gidAB-yyaA thdF None Positive 4212926..4212948 None TTTGGCATAATAAAAATTTTTTT Ogura M, et al. (2002): AR RG HM DB
ybdK ybdK None Positive 221720..221737 None AAAATTTTCTTTTATTTA Ogura M, et al. (2002): AR RG HM DB
ybdK ybdK None Positive 221758..221776 None CCTGACAAAGGAACATTTC Ogura M, et al. (2002): AR RG HM DB
yhbIJ-yhcABCDEFGHI yhcE None Positive ND ND ND Ogura M, et al. (2002): AR RG DB
yhbIJ-yhcABCDEFGHI yhcF None Positive ND ND ND Ogura M, et al. (2002): AR RG DB
yhbIJ-yhcABCDEFGHI yhcH None Positive ND ND ND Ogura M, et al. (2002): AR RG DB
yhjCB yhjB None Positive 1120937..1120958 None AAAATAAATTTATTTATAATTC Ogura M, et al. (2002): AR RG HM DB
yhjCB yhjB None Positive 1120902..1120922 None CACTCCAAAAAATGACATGTG Ogura M, et al. (2002): AR RG HM DB
yneAB-ynzC yneA None Positive ND ND ND Ogura M, et al. (2002): AR RG DB
yneAB-ynzC yneB None Positive 1918587..1918609 None TAAACAAAAATGATTTTATTGAA Ogura M, et al. (2002): AR RG HM DB
yneAB-ynzC yneB None Positive 1918618..1918640 None TGATAAAAATCAACTTCAAACCT Ogura M, et al. (2002): AR RG HM DB
radC radC None Positive 2862759..2862781 None AAGACAGAAGTTGCGTTTTGGTC Ogura M, et al. (2002): AR RG HM DB
radC radC None Positive 2862738..2862759 None CCCTCAGTGAAGAAGAGATTTG Ogura M, et al. (2002): AR RG HM DB
yvrPON yvrP None Positive 3415410..3415429 None ATATGACTTGATTAAAAATG Ogura M, et al. (2002): AR RG HM DB
yvrPON yvrP None Positive 3415373..3415393 None TGTATGAAAAAATCCCGGTTT Ogura M, et al. (2002): AR RG HM DB
ywpH-glcR ywpH None Positive 3740687..3740710 None AAAAGTACATATTTCTTCAAAGGA Ogura M, et al. (2002): AR RG HM DB
ywpH-glcR ywpH None Positive 3740667..3740687 None AAAAAAGCAAAAGATGTTTTT Ogura M, et al. (2002): AR RG HM DB
yyaF-rpsF-ssb-rpsR yyaF None Positive 4201054..4201070 None ATCAAAGGGATTGGCAA Ogura M, et al. (2002): AR RG HM DB
yyaF-rpsF-ssb-rpsR yyaF None Positive 4201037..4201054 None AGCTGAAAATGCTTTTTT Ogura M, et al. (2002): AR RG HM DB




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai