Transcription factor: CtsR

Factor type two-component response regulator
SWISS-PROT ND
SubtiList ND
Consensus seq. A/GGTCAAA NAN A/GGTCAAA
Comment binding to a directly repeated heptanucleotide operator sequence (A/GGTCAAANANA/GGTCAAA); three functional domains: HTH DNA-binding, dimerization, and putative heat-sensing domains; active as a dimer; specifically degraded by ClpP and ClpX at 37 degrees C; labile and substrate of the ClpCP protease under stress conditions (autoregulation by controlled proteolysis); negatively regulates its own synthesis
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
clpE clpE SigA Negative 1437936..1437959 -33:-9 AAAGTCAAAGATAGTCAGAGTATA Derre I, et al. (1999): GS FT
clpE clpE SigA Negative 1437908..1437932 -5:+20 TTAATCAAAGTTGGTCAAACAAACC Derre I, et al. (1999): GS FT
clpE clpE SigA Negative 1437865..1437888 +40:+63 TTGGTCAAAGATAGTCAAATATTC Derre I, et al. (1999): GS FT
clpE clpE SigA Negative 1437790..1437813 -5:+19 ATAGTCAAAGAAGGTCAAACCCAA Derre I, et al. (1999): GS FT
clpE clpE SigA Negative 1437743..1437767 +42:+66 TTGGTCAAAGATGATCAAATTATTA Derre I, et al. (1999): GS FT
clpP clpP SigA Negative 3546165..3546181 -36:-20 TTTGACCTTTATTGACC Derre I, et al. (1999): GS FT
clpX clpX SigA Negative ND ND ND Kruger E, et al. (1998): DB
ctsR-mcsAB-clpC-radA-yacK ctsR SigA Negative 101409..101437 +1:+29 AAAGTCAAATATAGTCAAAGTCAGTAAAG Derre I, et al. (1999): GS FT
lonA-ysxC lonA SigA Negative ND ND ND Kruger E, et al. (1998): DB
trxA trxA None Negative ND ND ND Kruger E, et al. (1998): DB




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai