Transcription factor: DegU

Factor type LuxR/UhpA family
SWISS-PROT ND
SubtiList ND
Consensus seq. TAAAT
Comment pleiotropic regulator involved in various post-exponential phase responses; makes a two component system with DegS kinase
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
amyE amyE SigA Positive ND ND ND Ayusawa D, et al. (1975): DB, amylase activity
Yoneda Y & Maruo B (1975): DB, amylase activity
Steinmetz M, et al. (1976): DB, amylase activity
Lepesant JA, et al. (1976): Microbiology-1976, edited by David Schlessinger; pages 58-69: DB, amylase activity
aprE aprE SigA Positive 1105645..1105704 -83:-24 GATATACCTAAATAGAGATAAAATCATCTCAAAAAAATGGGTCTACTAAAATATTATTCC Kunst F, et al. (1974): serine protease activity; DB
Ayusawa D, et al. (1975): protease activity; DB
Yoneda Y & Maruo B (1975): serine protease activity; DB
Lepesant JA, et al. (1976): Microbiology-1976, edited by David Schlessinger; pages 58-69: DB, serine protease activity
Ferrari E, et al. (1986): DB RG
Tanaka T & Kawata M (1988): serine protease activity; DB
Henner DJ, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.3-9: DP RG
Mukai K, et al. (1992): DP DB OV RG
Ogura M, et al. (2003): RG DB GS
Shimane K & Ogura M (2004): SDM DB RG
Kobayashi K, et al. (2010): AR HB DB GS
licT-bglS bglS SigA Positive ND ND ND Aymerich S et al. (1986): DB, glucanase activity
comK comK SigA Positive 1116971..1117005 -102:-73 TTATTACTAGTCATTTAGTACCATTAAATATCATT Hahn J, et al. (1994): DB
Van Sinderen D & Venema G (1994): RG DB; Western blot
Ogura M, et al. (1996): DB RG
Hamoen LW, et al. (2000): GS FT
Shimane K & Ogura M (2004): SDM RG
degQ degQ SigA Positive ND ND ND Msadek T, et al. (1990): DB RG
Msadek T, et al. (1991): DP DB RG
ispA ispA SigA Positive ND ND ND Ruppen ME, et al. (1988): DB RG, protease activity
nprE nprE SigA Positive ND ND ND Kunst F, et al. (1974): neutral protease activity; DB
Ayusawa D, et al. (1975): protease activity; DB
Yoneda Y & Maruo B (1975): neutral protease activity; DB
Lepesant JA, et al. (1976): Microbiology-1976, edited by David Schlessinger; pages 58-69: DB, metal protease activity
Tanaka T & Kawata M (1988): neutral protease activity; DB
sacB-yveBA sacB SigA Positive 3535696..3535721 -110:-85 GATAGATTTTTTAGTTCTTTAGGCCC Kunst F, et al. (1974): levansucrase activity; DB
Steinmetz M, et al. (1976): DB, levansucrase activity
Lepesant JA, et al. (1976): Microbiology-1976, edited by David Schlessinger; pages 58-69: DB, levansucrase activity
Chambert R & Petit-Glatron MF (1984): levansucrase activity; SDS-PAGE DB
Aymerich S et al. (1986): RG DB dot-blot
Shimotsu H & Henner DJ (1986): S1 RG DB
Klier A et al. (1987): levansucrase activity, DB DP
Henner DJ, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.3-9: DP RG
Tsukahara K, et al. (2008): FT HB SDM
sacXY sacX SigA Positive 3941835..3941891 -112:-56 GTCTTAAAGGTTTTTTTCATTCTAAGAACACCACACACAACCTTTTTCCCATCCATT Crutz AM & Steinmetz M (1992): DB RG DP
sipS sipS None Positive 2433527..2433547 -648:-628 GATGTAATGAAAAGGAGATCG Bolhuis A, et al. (1996): DB OV RG NB
Tjalsma H, et al. (1998): OV RG
sipT sipT None Positive 1511245..1511266 None TTTTTTATGATAAAGTAAAAGA Tjalsma H, et al. (1998): OV RG NB
wapA-yxxG wapA SigA Negative 4030602..4030625 -42:-19 AAAAATATTGTAATGATATTTCAG Dartois V, et al. (1998): DB RG DP PE SDM
wapA-yxxG wapA SigA Negative 4030563..4030579 +5:+21 ATATTACTTTTATTACA Dartois V, et al. (1998): DB RG DP PE SDM
yxjJI yxjJ None Negative ND ND ND Dartois V, et al. (1998): Unpublished data
ywsC-ywtABC ywsC None Positive 3700687..3700711 -47:-23 ACATAATGCCGATTGAGAATTCATA Ohsawa T, et al. (2009): GS FT
ywsC-ywtABC ywsC None Positive 3700687..3700711 -47:-23 ACATAATGCCGATTGAGAATTCATA Ohsawa T, et al. (2009): GS FT
degSU degU sigA Positive 3645305..3645385 -72:+7 TCTTTGACTATGATTTGTAAAATAGAGCCAAAAGGCATATTGACCGAATGCTAGAGTATATAGAACAATAATACAAGGAGG Yasumura A, et al. (2008): RG NB DP DB OV
Ogura M, (2010): FT GS SDM
Kobayashi K, et al. (2010): AR HB DB GS
degSU degU sigA Positive 3645386..3645417 -106:-75 GGGACATTTATTATGATTAAGGTTCCGTTATC Ogura M, et al (2010): FT GS SDM
Kobayashi K, et al. (2010): AR HB DB GS
ycdA ycdA SigA Positive 300723..300813 -130:-40 CCAACTAATCAAAAAGTAATAGTCTAAAATACACAGTTTTCTGAGTTTACCAGTTTTACCAGAACATTTTTCACCAAAAATAGGATGATGA Kobayashi K, et al. (2010): AR HB DB GS
Ogura M, et al. (2012): GS FT DP
yukEDCB-yueB yukE SigA Positive ND ND ND Kobayashi K, et al. (2010): AR HB DB GS
fla-che flgB SigA Negative ND ND ND Amati G, et al. (2004): RG GS
fla-che flgB SigA Positive 1691108..1691148 -106:-66 CTAACAATCTAGGACTTTATACCTAGTTGCAAAATAGATAA Tsukahara K, et al (2008): FT
Kobayashi K, et al. (2010): AR HB DB GS
fla-che flgB Positive 1691328..1691356 +115:+145 AGCGGATATTAAGCAAAAAGTCATAACTA Tsukahara K, et al (2008): FT
Kobayashi K, et al. (2010): AR HB DB GS
bpr bpr SigA Positive 1599043..1599138 -155:-60 TTATAAAGTCTTTTTCCCTATTGCTTCCTTCGCTTAGTAACAAAACAGATAATTAGACCCATTTATTTTTGTGACATTTTTATCATTTTCATATAT Tsukahara K, et al (2008): FT RG SDM




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai