Transcription factor: DeoR

Factor type two-component response regulator
SubtiList ND
Consensus seq. TTCAAT
Comment deoxyribonucleoside regulator; represses the expression of a downstream operon, dra-nupC-pdp; 30% identical to the sorC repressor from K. pneumoniae
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
deoR-dra-nupC-pdp dra SigA Negative 4052324..4052362 -60:-22 ATTGAACAAAATTTCAATTACCAATTTACATATGTTCAA Zeng X, et al. (2000): GS FT
Zeng X & Saxild HH (1999): DP RG DB SDM GS
Saxild HH, et al. (1996): DB HM

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai