Transcription factor: GltC

Factor type LysR
SWISS-PROT ND
SubtiList ND
Consensus seq. ATCTCANNNTGAGAT, ATCTAANNNATATAT
Comment Like many members of LysR family, GltC is encoded just upstream of and in the opposite orientation to its target genes (gltAB); it negatively autoregulates itself. The binding site for the autoregulation is the same with the box I of gltA (-71:-57) in its genome position. Box II of gltA overlaps with its -35 region. cf. GltR
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
gltAB gltA SigA Positive 2014669..2014778 -90:+20 GTTTGTCTCACATCCATCTATCTCATTTTGAGATTCTTTTGATCTAAATTATATATTGTTTATATCGTTTTGAAAACCTACAATGATTATAGAGTTGTTAGATTTTATGA Belitsky BR, et al. (1995): SDM DP
Piccossi S, et al. (2007): FP
Commichau FM, et al. (2007): RG, in vivo protein interaction assay
Bohannon DE, et al. (1989): S1
gltC gltC SigA Negative 2014745..2014759 +5:+19 ATCTCAAAATGAGAT Belitsky BR, et al. (1995): SDM DP
Bohannon DE, et al. (1989): S1




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai