Transcription factor: GltR

Factor type LysR
SWISS-PROT ND
SubtiList ND
Consensus seq. T-----------A
Comment it activates the transcription of gltAB in the absense of the normal regulator, GltC. It also negatively regulates its own expression. cf. GltC
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
gltAB gltA SigA Positive 2014745..2014759 -71:-57 ATCTCATTTTGAGAT Belitsky BR, et al. (1997): DB DP SDM
gltAB gltA SigA Positive 2014723..2014737 -49:-35 ATCTAAATTATATAT Belitsky BR, et al. (1997): DB DP SDM
gltR gltR SigA Negative 2725781..2725795 -10:+5 ATTCAAAATTAAGAT Belitsky BR, et al. (1997): DB DP SDM
gltR gltR SigA Negative 2725793..2725827 +3:+37 GATGGAAGACATCTCAAAATCAGATATCAACTATG Belitsky BR, et al. (1997): DB DP SDM




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai