Transcription factor: GutR

Factor type Unique (ATP-GTP binding)
SubtiList ND
Consensus seq. ND
Comment putative helix-turn-helix type regulator; located immediately upstream of gutB and is transcribed in the opposite direction; probably acts as an activator
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
gutBP gutB SigA Positive 667324..667352 -78:-50 ATAAAAGTACAGTGCCGCTGTCCTTTTAT Ye R, et al. (1994): DB
Ye R, et al. (1994): DP RG
Poon KK, et al. (2001): GS RG

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai