Transcription factor: Hpr

Factor type Unique (MarR Family)
SWISS-PROT ND
SubtiList ND
Consensus seq. [A/G]ATANTAT[T/C]
Comment One of the transition-state regulators (like Sin) used during the transition state between vegetative growth and the onset of sporulation; transition-state regulators are reviewed in Strauch, M.A. and Hoch, J.A., 1993
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
appDFABC appD None Negative ND ND ND Koide A, et al. (1999): DB OV
aprE aprE SigA Negative 1105921..1105950 -324:-295 AGTTTATTTTTCAGAATACTTTTATCATCA Higerd TB, et al. (1972): serine protease activity
Ferrari E, et al. (1986): DB RG
Henner DJ, et al. (1988): DP RG DB NB PE
Henner DJ, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.3-9: DP RG
Kallio PT, et al. (1991): GS FT
Abe S. et al. (2009): Disruption of glnA, glutamine synthetase gene
aprE aprE SigA Negative 1105893..1105918 -292:-267 CTTTGAAAAAATATCACGATAATATC Higerd TB, et al. (1972): serine protease activity
Ferrari E, et al. (1986): DB RG
Henner DJ, et al. (1988): DP RG DB NB PE
Henner DJ, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.3-9: DP RG
Kallio PT, et al. (1991): GS FT
aprE aprE SigA Negative 1105685..1105705 -79:-59 TGATATACCTAAATAGAGATA Higerd TB, et al. (1972): serine protease activity
Ferrari E, et al. (1986): DB RG
Henner DJ, et al. (1988): DP RG DB NB PE
Henner DJ, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.3-9: DP RG
Kallio PT, et al. (1991): GS FT
aprE aprE SigA Negative 1105640..1105661 -35:-14 TACTAAAATATTATTCCATCTA Higerd TB, et al. (1972): serine protease activity
Ferrari E, et al. (1986): DB RG
Henner DJ, et al. (1988): DP RG DB NB PE
Henner DJ, et al. (1988): Genetics and biotechnology of Bacilli, vol.2 pp.3-9: DP RG
Kallio PT, et al. (1991): GS FT
Abe S. et al. (2009): Disruption of glnA, glutamine synthetase gene
epr epr SigD Negative 3939509..3939537 -332:-304 AGACAGACCCGATAATAATCAGCGGCATG Kodgire P, et al. (2006): DP RG GS DB SDM
ispA ispA SigA? Negative ND ND ND Ruppen ME, et al. (1988): DB RG
nprE nprE None Negative 1541717..1541742 -107:-82 CTTGATATTATTCAACAAAAACAAAC Higerd TB, et al. (1972): neutral protease activity
Kallio PT, et al. (1991): GS FT
nprE nprE None Negative 1541639..1541661 -26:-4 GAATGCTAGTTTAATATAACAAT Higerd TB, et al. (1972): neutral protease activity
Kallio PT, et al. (1991): GS FT
oppABCDF oppA None Negative ND ND ND Koide A, et al. (1999): DB OV
sinIR sinI SigA Negative 2552238..2552267 -86:-57 ATCTGCAAAATAATATTTCAAGCTAACTTT Kallio PT, et al. (1991): FT
Shafikhani SH, et al. (2002): FT RG
sinIR sinI SigA Negative 2552312..2552337 -12:+14 TATAATAAAGGTATATTGGAAAAAAA Kallio PT, et al. (1991): FT
Shafikhani SH, et al. (2002): FT RG
yclF yclF SigA? Positive 417769..417797 None AATGAGTATAAATTATATTGACACAAGTA Caldwell R, et al. (2001): AR HM
yclF yclF SigA Positive 417741..417769 None ATTATATAAGAATATGATTTTTATAATAC Caldwell R, et al. (2001): AR HM
ywfBCDEFG ywfB SigA Negative 3874209..3874262 -53:+1 ATCAATATTTTCAAAAAACATTGACAGTTCAATTTCCACTGGATAAAATTTACT Inaoka T, et al. (2009): PE, GS
phoPR phoP SigA,B,E Negative 2978716..2978759 -237:-193 AAAATGTCATGAAAGTATTATCCTAATAAAAAGAGAGAAAGGCT Kaushal B, et al. (2010): PE,FT
phoPR phoP SigA,B,E Negative 2978588..2978609 -87:-66 TTCGCTAAAATAAAATCATGAA Kaushal B, et al. (2010): PE,FT
phoPR phoP SigA,B,E Negative 2978528..2978578 -56:-6 GATGACATAAAATAGAGAAATAGGATGTCGGGGAATTATAATACTGGAGGC Kaushal B, et al. (2010): PE,FT
hag hag SigD Negative 3635992..3636009 -17:+1 AATCCGATATTAATGATG Kodgire P, et al. (2008): GS SDM
hag hag SigD Negative 3635878..3635892 +10:+24 AACCACAATATTGCA Kodgire P, et al. (2008): GS SDM




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai