Transcription factor: HrcA

Factor type Unique (CIRCE)
SWISS-PROT ND
SubtiList ND
Consensus seq. TTAGCACTC---------GAGTGCTAA
Comment the promoters of class I heat-inducible genes are sigA-dependent and have an inverted repeat, called the CIRCE (controlling IR of chaperone expression) element, which is highly conserved among eubacteria; heat-shock and general stress responses are reviewed in Hecker, M. et al., 1996
Link to Phylogenetic profile, Weight matrix & Motif alignment

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
groESL groES SigA Negative 649841..649867 +5:+31 TTAGCACTCTTTAGTGCTGAGTGCTAA Hecker M, et al. (1996): HB GS
Voelker U, et al. (1994): 2D PAGE, HB
lepA-hemN-hrcA-grpE-dnaKJ-yqeTUV hrcA SigA Negative 2629652..2629678 +5:+31 TTAGCACTCGCTTATTGAGAGTGCTAA Zuber U, et al. (1994): SDM HB
Voelker U, et al. (1994): 2D PAGE, HB




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai