Transcription factor: HutP

Factor type Unique
SubtiList ND
Consensus seq. ND
Comment proposed to mediate the histidine-dependent induction of hut operon expression through antitermination. HutP requires L-histidine and an Mg2+ ion for binding to the specific sequence within the hut mRNA. Kumarevel T, et al. (2005) show that several divalent cations can mediated the HutP-RNA interactions. It could not be replaced by monovalent cations.
Link to Phylogenetic profile

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
hut hutH SigA Positive 4041959..4042010 Between hutP and hutH CGATAGGGGGCTATGCGTGAAAACAGAAGTTCACAGCATAGCTCCTTTTTGT Wray LV Jr, et al. (1994): RO SDM
Oda M, et al. (2000): GS

Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai