Transcription factor: IolR

Factor type DeoR
SWISS-PROT ND
SubtiList ND
Consensus seq. WRAYCAADARDWRAYCAADARD
Comment a negative regulator (presumably a repressor) which exists immediately upstream of the iol operon in the opposite direction
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
iolRS iolR SigA Negative 4084676..4084727 -94:-43 AGAAGGCCGTCCAATCTTGCAAAAGATATACACCGATGTTATCATTTTTAAG Yoshida KI, et al. (1997): DB DP HB
iolRS iolR SigA Negative 4084730..4084751 -40:-19 ACTATTGATTAACTTTTGGTTT Yoshida KI, et al. (1999): GS FT
ydjK ydjK SigA Negative 676152..676240 -2:+87 TCAGATATAACAAAAATGTCACTATAACATCACTACAATTGAACTATTAAGTGACTAATAAATACCAAATGAACGAGGTTATGCACAAA Yoshida K, et al. (2002): NB PE FT
mmsA-iolBCDEF-idh-iolHI-fbaB mmsA SigA Negative 4084619..4084681 -107:-45 CCTTCTCTTACTTCTCTTACTTGATTAAAAGATTAATATAATAAAAATAATGAAAAAATGTAG Yoshida KI, et al. (1997): DB DP HB
mmsA-iolBCDEF-idh-iolHI-fbaB mmsA SigA Negative 4084558..4084579 -5:+17 TAACCAAGAAATGACCAAAAAG Yoshida KI, et al. (1999): GS FT




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai