Transcription factor: LexA

Factor type UmuD/LexA
SWISS-PROT ND
SubtiList ND
Consensus seq. CGAACATATGTTCG
Comment Negative regulator of DNA damage-inducible genes; SOS-like or SOS regulon; analogue of E. coli LexA
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
aprX aprX SigA Negative 1862873..1862896 -157:-134 TAATACGAACAAACGTTCTTTTTC Au N, et al. (2005): GS AR DB
dinB dinB None Negative 608801..608824 None ACATAAGAACTCATGTTCGTGTAT Cheo DL, et al. (1991): DB RG
Lovett CM Jr, et al (1993): GS
Miller MC, et al. (1996): GS
Winterling KW, et al. (1998): GS
Au N, et al. (2005): GS AR DB
Groban ES, et al. (2005): GS
tagC tagC None Negative 3683335..3683358 None AAAACAGAACAAGTGTTCTTTTTT Raymond-Denise A & Guillen N (1991): DB RG
Cheo DL, et al. (1991): DB RG DP
Lovett CM Jr, et al (1993): GS FT
Miller MC, et al. (1996): GS FT
Winterling KW, et al. (1998): GS
Au N, et al. (2005): GS AR DB
Groban ES, et al. (2005): GS
tagC tagC None Negative 3683365..3683388 None AATACCGAACGTATGTTTGCTTTA Raymond-Denise A & Guillen N (1991): DB RG
Cheo DL, et al. (1991): DB RG DP
Lovett CM Jr, et al (1993): GS FT
Miller MC, et al. (1996): GS FT
Winterling KW, et al. (1998): GS
Au N, et al. (2005): GS AR DB
Groban ES, et al. (2005): GS
dnaE dnaE None Negative 2994673..2994696 None AAAAAAGAACATTTGTTTCTTTTG Le Chatelier E, et al. (2003): DB RG, Western blot
Au N, et al. (2005): GS
hbs hbs None Negative 2386083..2386106 None AAAAAGGAATATTCGTTCGGTAAA Au N, et al. (2005): GS
lexA lexA None Negative 1918310..1918333 -44:-21 TTTTTCGAACCTATGTTTGTACTG Raymond-Denise A & Guillen N (1991): DB RG
Haijema BJ, et al. (1996): DB RG DP GS
Winterling KW, et al. (1998): GS FT
Au N, et al. (2005): GS AR DB
lexA lexA None Negative 1918339..1918362 -72:-49 ATATACGAACAAACGTTTCTGTCA Raymond-Denise A & Guillen N (1991): DB RG
Haijema BJ, et al. (1996): DB RG DP GS
Winterling KW, et al. (1998): GS FT
Au N, et al. (2005): GS AR DB
lexA lexA None Negative 1918376..1918399 -109:-86 CAACAGGAATGTTTGTTCGCATTT Raymond-Denise A & Guillen N (1991): DB RG
Haijema BJ, et al. (1996): DB RG DP GS
Winterling KW, et al. (1998): GS FT
Au N, et al. (2005): GS AR DB
parEC parE None Negative 1933253..1933276 None ATAAACAAACATACGTTCTCATAG Au N, et al. (2005): GS AR DB
pcrBA-ligA-yerH pcrA None Negative 719330..719353 None ATGATAGAACGTATGTTTTGTATA Au N, et al. (2005): GS AR DB
recA recA SigA Negative 1764554..1764577 -60:-37 AAATCCGAATATGCGTTCGCTTTT Raymond-Denise A & Guillen N (1992): DB RG
Lovett CM Jr, et al (1993): GS, promoter mutations
Haijema BJ, et al. (1996): DB GS DP, Western blot
Miller MC, et al. (1996): GS, in-vitro transcription
Winterling KW, et al. (1997): GS RG, promoter mutations
Winterling KW, et al. (1998): GS FT RG, promoter mutation
Hamoen LW, et al. (2001): GS
Au N, et al. (2005): GS AR DB
Groban ES, et al. (2005): GS, promoter mutations
ruvAB ruvA None Negative 2836830..2836853 None AGAAGCGAACATATGTTAACTTTT Au N, et al. (2005): GS AR DB
sda sda SigA Negative 2647325..2647348 -47:-24 ATAACAGAACGATTGTTCTTATAT Au N, et al. (2005): GS
uvrBA uvrB None Negative 3615004..3615027 None ACCACCGAACTTTAGTTCGTATTT Cheo DL, et al. (1991): DB RG DP
Lovett CM Jr, et al (1993): GS
Winterling KW, et al. (1998): GS
Au N, et al. (2005): GS AR DB
Groban ES, et al. (2005): GS
uvrC uvrC None Negative 2912928..2912951 None AGAGAAAAACAAACGTTCGTGTTA Au N, et al. (2005): GS AR DB
vpr vpr None Negative 3907649..3907672 None GTATACGAACGTATATTCCTAACT Au N, et al. (2005): GS
xkdA xkdA None Negative 1321177..1321200 None AAAACAGAACAAACGTTCGAAAGG Au N, et al. (2005): GS AR DB
ybaK-cwlD ybaK SigG Negative 155965..155988 -124:-101 ATTACAGAACATTTGTTCCTCACC Au N, et al. (2005): GS AR DB
ydgGH ydgG None Negative 608801..608824 None ATACACGAACATGAGTTCTTATGT Au N, et al. (2005): GS
ydiOP ydiO None Negative 655154..655177 None GATAAAGAACATTCGTTCTTGTAT Au N, et al. (2005): GS AR DB
yhaONM yhaO None Negative 1064778..1064801 None TTGACAGAACGTGCATTCGCAAGA Au N, et al. (2005): GS AR DB
yhaZ yhaZ None Negative 1056250..1056273 None GATCCAGAACGTACATTCCCATAC Au N, et al. (2005): GS AR DB
yhjD yhjD None Negative 1121414..1121437 None CAAATAGAACAAACGTTCCCTTAG Au N, et al. (2005): GS AR DB
yhjE-sipV yhjE None Negative 1121414..1121437 None CTAAGGGAACGTTTGTTCTATTTG Au N, et al. (2005): GS
ykvR ykvR None Negative 1447123..1447145 None TTAACGAACGTATGTTTGTAAAG Au N, et al. (2005): GS
yneAB-ynzC yneA None Negative 1918310..1918333 None CAGTACAAACATAGGTTCGAAAAA Kawai Y, et al. (2003): NB
Au N, et al. (2005): GS AR DB
yneAB-ynzC yneA None Negative 1918339..1918362 None TGACAGAAACGTTTGTTCGTATAT Kawai Y, et al. (2003): NB
Au N, et al. (2005): GS AR DB
yneAB-ynzC yneA None Negative 1918376..1918399 None AAATGCGAACAAACATTCCTGTTG Kawai Y, et al. (2003): NB
Au N, et al. (2005): GS AR DB
yolC yolC None Negative 2272011..2272034 None TTAACAGAACAAACGTTCTTCATT Au N, et al. (2005): GS
yolC yolC None Negative 2272041..2272064 None AAACCAGAACAAAAGTTCGATGTA Au N, et al. (2005): GS
yolD-uvrX yolD None Negative 2272041..2272064 None TACATCGAACTTTTGTTCTGGTTT Au N, et al. (2005): GS
yolD-uvrX yolD None Negative 2272011..2272034 None AATGAAGAACGTTTGTTCTGTTAA Au N, et al. (2005): GS
yorBC yorB None Negative 2188172..2188195 None TAACGAGAACACTTGTTCCCTTTA Au N, et al. (2005): GS
yozLK-yobH yozL None Negative 2064927..2064950 None TACATCGAACTTTTGTTCTGATCT Au N, et al. (2005): GS
yozLK-yobH yozL None Negative 2064897..2064920 None AATAAGGAACGTTTGTTCTGTTGA Au N, et al. (2005): GS
yozM yozM None Negative 2064897..2064920 None TCAACAGAACAAACGTTCCTTATT Au N, et al. (2005): GS
yozM yozM None Negative 2064927..2064950 None AGATCAGAACAAAAGTTCGATGTA Au N, et al. (2005): GS
ypuD ypuD None Negative 2432233..2432256 None AAAACAGAACATAAATTCGTATAT Au N, et al. (2005): GS
yqhB yqhB None Negative 2561450..2561473 None TCCTCCAAACTTTTGTTCTTTATT Au N, et al. (2005): GS
yqjWX yqjW None Negative 2465838..2465861 None TAAAACGAACATACTTTCGCATAT Au N, et al. (2005): GS AR DB
yqjWX yqjW None Negative 2465810..2465833 None AAAAGCGAACATAAGTTCTTTTTA Au N, et al. (2005): GS AR DB
yqxL yqxL SigB Negative 2561450..2561473 None AATAAAGAACAAAAGTTTGGAGGA Au N, et al. (2005): GS
yqzH yqzH None Negative 2465838..2465861 None ATATGCGAAAGTATGTTCGTTTTA Au N, et al. (2005): GS
yqzH yqzH None Negative 2465810..2465833 None TAAAAAGAACTTATGTTCGCTTTT Au N, et al. (2005): GS




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai