Transcription factor: MntR

Factor type DtxR family
SWISS-PROT ND
SubtiList ND
Consensus seq. wAwTTTGCmTkArGGAAACT and others
Comment regulation of manganese transport (repression of mntH in high Mn(II) conditions, activation of mntABCD under low Mn(II) conditions)
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
mntABCD mntA None Positive at low Mn(II) concentration 3146070..3146089 None AATTTTGCATGAGGGAAACT Que Q & Helmann JD (2000): DB GS RG HM
mntH mntH None Negative at high Mn(II) concentration 492465..492484 None TAATTTGCCTTAAGGAAACT Que Q & Helmann JD (2000): DB GS RG HM




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai