Transcription factor: Mta

Factor type MerR family
SWISS-PROT ND
SubtiList ND
Consensus seq. ND
Comment The N-terminal domain of Mta(MtaN) acts as a constitutive activator of the transcription of bmr and blt genes.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
blt-bltD blt SigA Positive 2716869..2716890 -35:-14 GACTATACGGTAACCATATACC Baranova NN, et al. (1999): NB FT
bmrU-bmr-bmrR bmr SigA Positive 2494593..2494614 -35:-14 GACTCTCCCCTAGGAGGAGGTC Baranova NN, et al. (1999): NB FT
mta mta SigA Positive 3764934..3764956 -35:-13 GACCCTAACGTTGCGTGATTGTT Baranova NN, et al. (1999): NB FT
ydfK ydfK SigA Positive ND ND ND Baranova NN, et al. (1999): NB




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai