Transcription factor: PerR

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. TTATAATNATTATAA
Comment transcription induced by hydrogen peroxide, by general stress, or by entry into stationary phase under conditions of iron and manganese limitation (class III stress response); expression modulated by Ca2+; mutants lead to higher expression from all peroxide regulon promoters (mrgA, katA, hemAXCDBL, and ahpCF), but has no effect on spore resistance to alkyl hydroperoxides, heat or hydrogen peroxide
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
ahpCF ahpC SigA Negative 4118850..4118911 -36:+26 CTTGACAAAAAATATATATTAATTAATAATTCATATATAATTAGAATTATTATTGAAAGCGA Herbig AF, et al. (2001): FT
fur fur SigA Negative 2450346..2450378 -61:-29 TTATTTATCAGTTTATAATAATTATAGTTGGAA Fuangthong M, et al. (2002): FT
hemAXCDBL hemA SigA Negative 2879194..2879222 None AGAAACTATGTTATAATTATTATAAATAA Herbig AF, et al. (2001): FT
hemAXCDBL hemA SigA Negative 2879148..2879189 None TTCTATGTTAGAATGATTATAAATTAAGATTGGGTGTTGGGG Herbig AF, et al. (2001): FT
katA katA None Negative 961012..961069 None CTATTTTATAATAATTATAAAATAATATTGACTTTTTACTTAGAGATGATATTATGTT Herbig AF, et al. (2001): FT
Engelmann S, et al. (1995): NB
Bol DK & Yasbin RE (1994): RG HB PE
mrgA mrgA SigA Negative 3383477..3383530 -60:-7 CTAAATTATAATTATTATAATTTAGTATTGATTTTTATTTAGTATATGATATAA Herbig AF, et al. (2001): FT
srfAA-srfAB-comS-srfAC-srfAD srfAA SigA Positive 376515..376565 -163:-113 TTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGG Hayashi K, et al. (2005): GS FT
perR perR SigA Negative 944427..944452 -13:+13 TTACACTAATTATAAACATTACAATG Fuangthong M, et al. (2002): FT
perR perR SigA Negative 944436..944458 -4:+19 TTATAAACATTACAATGTAAGAA Fuangthong M, et al. (2002): FT
ykvW ykvW SigA Negative 1451189..1451239 -75:-25 TAATGATAATTATTATCAAAAAGAAATTAAAATAATTATAATTGAAATTCT Gaballa A, et al. (2002): FT
yjbCD yjbD None Negative 1227579..1227658 -40:+40 GATACTGTTCACACTTACTTTTTTATAGTATAATACCTGTAAAGATTCCTTTTTTAGAGTAATTTCAATTTAAGAATAAA Leelakriangsak M, et al. (2007): FT




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai