Transcription factor: RocR

Factor type NtrC/NifA
SWISS-PROT ND
SubtiList ND
Consensus seq. GCAAAATAATTTTGCA(T/C)T
Comment NtrC/NifA transcriptional activator (cf. LevR). Sigma 54-dependent activators generally bind two inverted repeat sequences called UAS, which are located approx. 100bp upstream from the -12/-24 promoters. DNA bending is used for activation (AhrC may be involved). Inducible by ornithine or citrulline? At least upstream UAS1 is the target of RocR
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
rocABC rocA SigL Positive 3880707..3880730 -217:-194 CCTCCGCAAAATAATTTTGCATTT Ali NO, et al. (2003): FT DP
Calogero S, et al. (1994): DB
rocABC rocA SigL Positive 3880658..3880686 -173:-145 AAAACGCAAAATAAATTTGCGTTCAAGAT Ali NO, et al. (2003): FT DP
Calogero S, et al. (1994): DB
rocDEF rocD SigL Positive 4145663..4145683 -130:-110 TATGCAAAAGAATTTTGCACT Gardan R, et al. (1995): DP RG HM
rocDEF rocD SigL Positive 4145622..4145642 -89:-69 ATATCAGAATGTTTTTGCACC Gardan R, et al. (1995): DP HM
rocG rocG SigL Positive 3880707..3880730 downstream of rocG CCTCCGCAAAATAATTTTGCATTT Belitsky BR & Sonenshein AL (1999): RG DP
Ali NO, et al. (2003): FT DP
rocG rocG SigL Positive 3880658..3880686 downstream of rocG AAAACGCAAAATAAATTTGCGTTCAAGAT Belitsky BR & Sonenshein AL (1999): RG DP
Ali NO, et al. (2003): FT DP
rocR rocR SigA Negative 4145663..4145683 -50:-30 AGTGCAAAATTCTTTTGCATA Gardan R, et al. (1995): DB PE RG




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai