Transcription factor: SigE

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. (g/t)(c/a)ATATT(-35) - 14bp -CATACA-T(-10), G(g/t)(C/a)AT(A/g)(T/a)(t/c)(-35) - 13bp - (C/a)ATACA(a/c)T(-10)
Comment RNA polymerase sporulation-specific sigma-29 factor. Inactive precursor, processed by SpoIIGA after Tyr-27; synthesized shortly after the start of sporulation but do not become active until after polar division; expression negatively regulated by sigma-K; disappears in the forespore shortly after septation through a SpoIIIE-dependent process, probably by selective degradation of both SigE and SpoIIGA; pro-sigma-E associated with the cytoplasmic membrane in the predivisional sporangium, then accumulated at the mother cell side of the sporulation septum, and mature sigma-E distributed throughout the mother cell cytoplasm; transcription reduced, and probably processing impeded, in hyperosmotic conditions.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
asnO asnO 1157142..1157186 -40:+5 ACAAATCAACTATCTGCCTATAGATGCATAAACTTACTAAGGTGC Yoshida K, et al. (1999): NB PE
bdbDC bdbD ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
bofA bofA 29705..29745 -39:+2 AGTGGTCTAAACTCCTGGATCTTCTCATAAGCTTGTACTAG Ricca E, et al. (1992): DP
Ireton K & Grossman AD (1992): PE RG DB OV
cotE cotE 1774933..1774975 -40:+3 TAAGTAAAGTTTCTAGGCACCCCTGCATACAATGGAACAGAAA Zheng LB & Losick R (1990): PE S1 RG DP DB
cotJABC-yesJK cotJA 755839..755882 -38:+6 TTAGTCATAATCATGCCTCCTGCCTCATACCTATTAAGGTCATT Henriques AO, et al. (1995): PE DB RG
ctaA ctaA 1558977..1559029 -47:+6 GCCACAAAACACATATTCGCTTACACTTGGAACGTATATAAAATTGCAGCAGT Paul S, et al. (2001): PE DB
Mueller JP & Taber HW (1989): S1
ybaK-cwlD cwlD 156549..156597 -39:+10 GTAATCATATTTCCCGACCCTGTCCCATAGTTATGTAATAACGGACAAG Sekiguchi J, et al. (1995): PE NB DB
cwlJ cwlJ 282409..282457 -37:+12 TCCGTCATCACTTCTGAAGTAATGAAATATGATGAAAAGAGATCAAGGG Ishikawa S, et al. (1998): PE NB RG DB
dacB-spmAB dacB 2424552..2424594 -36:+7 TTATTCATAACTGATGGACATGCGCATAAACTTGTACAAACCA Simpson EB, et al. (1994): PE
Buchanan CE & Ling ML (1992): DB, immunoassay
gerM gerM 2903120..2903166 -39:+8 TTCGGTCTATTTCCTAAAGAGGCTCGTATACATAATAGTACAAACAT Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
glgBCDAP glgB 3171655..3171697 -39:+4 CTTCGAATAAATACTATAAATGAAAACTATGATGTCAGAAAGG Hay RE, et al. (1986): S1, dinucleotide priming
Kiel JA, et al. (1994): RG
mmgABCDE-yqiQ mmgA 2514089..2514131 -39:+4 TCATTCATTCATGCCCGTTTCAAAGCATACATTCATAGAAGAC Bryan EM, et al. (1996): RG OV PE
nucB nucB 2652815..2652859 None TTAAAAATATTCTTCATCAAGCGCCCATACATTGAAATGAACAAA Van Sinderen D, et al. (1995): FT HM
phoB-ydhF phoB 621591..621639 -35:+14 CTAAAACTTCTCATAAAAGAATAACCATTATTTAAGGGTGCCAGTTCAT Chesnut RS, et al. (1991): PE DP
Abdel-Fattah WR, et al. (2005): RG; in-vitro transcription assay
phoPR phoP 2978554..2978603 -43:+7 AAAATAAAATCATGAAACATGTTAAGATGACATAAAATAGAGAAATAGGA Paul S, et al. (2004): PE, In-vitro reconstitution, DB
prkA prkA 973070..973114 -38:+7 CAAAGCATGTATCACGAGATGGCGGCATAGATTGTATCAAAGTAC Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
safA-coxA safA 2845891..2845936 -42:+4 TCCTTTACTCATAACTTCTTTTGTTCAGGCATATGTTGTGAAGAAA Takamatsu H, et al. (1999): PE
spoIID spoIID 3777781..3777823 -39:+4 AGAGTCATATTAGCTTGTCCCTGCCCATAGACTAGACTAGAGT Rong S, et al. (1986): RO S1
yqhV-spoIIIAABCDEFGH spoIIIAA 2537640..2537697 -55:+3 CATAAATAAAGAGAGGCTTGTCATAAAGTCTGCCTCACATCATACATTTTAAAGAAGC Illing N & Errington J (1991): RG DB PE OV
yqhV-spoIIIAABCDEFGH spoIIIAG 2534009..2534062 -40:+14 AAATAGAAATACAAGCTTCCCAGCGCGCATATATTCTAGAAGAAATGGCTGTCC Stragier P (2003): personal communication: PE RG
Guillot C, et al. (2007): PE
spoIIM spoIIM 2451078..2451119 -36:+6 AAGGGCATGTTTTTCTGTTTCTTTCATACAATCTATTAAATC Smith K, et al. (1993): RG DB PE RO, in-vitro transcription, OV
spoIIP-yqxA spoIIP 2634461..2634504 -40:+4 ACAGTTCTACTTCCTCTAGCTTGTTCATAGAGTAATTACTAGAC Frandsen N & Stragier P (1995): RG PE DB OV
spoIVA spoIVA 2387735..2387778 -40:+4 GATGTCATATTCAAATAGGACAACGTCATACACATATAGTGTCC Roels S, et al. (1992): NB RG DB OV PE
spoIVA spoIVA 2387822..2387863 -38:+4 AAAGGAATGAACCTTTCTCCCTTGCATACAAATAGGGAGAAA Roels S, et al. (1992): NB RG DB OV PE
spoIVCA spoIVCA 2654979..2655028 -44:+6 AAAATCTCCTCATTTGGACAAACAGCTGTTACATAGCATTACCCAAGGGG Sato T, et al. (1994): PE S1
spoIVCB-spoIIIC spoIVCB 2652915..2652962 -39:+9 CGGTACAGACACAGACAGCCTCCCGGTCACATACATTTACATATAGGC Kunkel B, et al. (1988): PE RG
spoIVFAB spoIVFA 2857651..2857702 -46:+6 TTCTTGACTAAACCGAATATTTGCCATGGACAAGACATATGATGTACAAACC Cutting S, et al. (1991): PE RG
spoVB spoVB 2829486..2829528 None CTTGTCATGCTTGGACGACATATACGCATATCTTTATTGTATA Popham DL & Stragier P (1991): RG
spoVD spoVD 1584149..1584192 -37:+7 ATCGTTCTACCTGTCCAAATTCAGGCATAAAATGAAACAAGCCT Daniel RA, et al. (1994): RG DB OV PE
murE-mraY-murD-spoVE-murG-murB-divIB-ylxWX-sbp spoVE 1590218..1590260 -37:+6 GGTGACATGTTTATAGATGCCGTGCATATGCTTAAGTAAGGGC Theeragool G, et al. (1993): PE S1 RG DB
Miyao A, et al. (1993): RO, RNAP purification
murE-mraY-murD-spoVE-murG-murB-divIB-ylxWX-sbp spoVE 1590077..1590125 -40:+9 CTGGGAATACAACATGTCAAACGTGTCGATAATGTTGAACAAGCAGTAT Theeragool G, et al. (1993): PE S1 RG DB
Miyao A, et al. (1993): RO, RNAP purification
spoVID-ysxE spoVID 2872786..2872829 -39:+5 CCACTCATATTTTCTCCAGTTCATACATACACCTTTAGTGACAT Beall B, et al. (1993): PE RG DB OV
spoVK spoVK 1874033..1874075 -40:+3 CATGGTTTGTCCACCCCATGTCCGTGAATACAATAAGAAATAA Errington J, et al. (1989): RG
Foulger D & Errington J (1991): PE RG
spoVM spoVM 1655319..1655362 -40:+4 GAGGTACTTTTTCGTTTGCAAAAGGCATATTAATAATGATAAGA Levin PA, et al. (1993): DB PE RG OV
spoVR spoVR 1015585..1015627 -39:+4 ACTATCATCTTTTGTCTGGCGGGCTCATACATTATAGATAAGT Beall B & Moran CP Jr (1994): PE RG DB OV
usd-spoIIID-mbl-flhOP usd 3748858..3748900 -38:+5 TTTAGCATATTCCCAAAAGAATGCTAATACACTGTTACAAACC Kunkel B, et al. (1989): RG DB
Tatti KM, et al. (1991): PE SDM RG DB OV
Decatur A, et al. (1997): RG
yaaH yaaH 25182..25224 -40:+3 ATAAACATGATCAGCGCTTTTCTTTCATACATTGATAGCGATA Kodama T, et al. (1999): NB PE
Kobayashi K, et al. (2001): AR
yabMNOPQ-divIC-yabR yabP 68139..68183 -39:+6 CTTGTTCTAAAAAAACCCCCCACCTCATACAATGCAGTAATAATG Asai K, et al. (2001): NB DB PE
ybaN ybaN 160573..160616 -35:+9 TCGGTTATATTCAATTGTCCATGCTCATAAGATGTAAAACAAGA Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
ycgFG ycgF 334563..334608 -37:+9 TTGTGCATAGCTTGGCCCGTTCCCGAATAAATTGTACAAGTTACAT Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
ydcA ydcA 515643..515689 -40:+7 TACGTACTATTTAAATGGTTTGTCTCATAAACGTGTTACTATAGATA Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
ydcC ydcC 516075..516123 -40:+9 GTCTGCATATTAGGGAAACCCCACTCATATATTTGATAGTGCATTAAGG Kuwana R, et al. (2002): RG
Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
ydhD ydhD ND ND ND Kodama T, et al. (2000): NB DB
yfhS yfhS 937013..937061 -38:+11 TAGCGTATAGTTCTTTTATTTCCACAAACAATAATGGCAAGAACTTTAA Yamamoto H, et al. (1999): PE NB DB
yfnHGFED yfnE 801172..801214 -37:+6 GTGAAAGCAAGCGTTATTATTCCTGCATATAATTCGAAGGAGC Eichenberger P, et al. (2004): Race-PCR
yhaX yhaX 1056632..1056679 -39:+9 GTTGTTCTAAACACAGAGACAGGGTCATATCCTATACACAAGTACAGT Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
Feucht A, et al. (2003): AR DB RG
yhbH yhbH 975104..975149 -40:+6 GTTTGTCAATTAAACGTGCATATGTGCATATGATGAATATAAATCT Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
Feucht A, et al. (2003): AR DB RG
yhcOP yhcO 989634..989683 -39:+11 AATGACACACTGCGAACTCAGGCTGCATAGAGTAAAAATAAAAAGGTACA Eichenberger P, et al. (2004): Race-PCR
yheCD yheC ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yhjR yhjR ND ND ND Kuwana R, et al. (2002): SDS-PAGE RG
yhxC yhxC ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yitCD yitC 1172580..1172632 -40:+13 TGCGGAACCATTAAGAGCCCGGCTGAATATGCTTTTTAGCAAAATGGTTTTAT Eichenberger P, et al. (2004): Race-PCR
yjbE yjbE ND ND ND Feucht A, et al. (2003): AR DB RG
yjbX yjbX 1248609..1248657 -39:+10 TTTCTTCTGATTTTCAGCTTTCTGTCATATAGATAGAATATGACACAAT Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
Feucht A, et al. (2003): AR DB RG
yjcA yjcA 1252104..1252154 -45:+6 CAAGATACAATTCATGAAGAATAGGGTTTTGGCATATATGTGAAGGGATCA Kuwana R, et al. (2003): NB DB PE
yjdH yjdH ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yjfA yjfA ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
uxaC-yjmBCD-uxuA-yjmF-exuTR-uxaBA yjmC 1303322..1303370 -46:+3 TATAATATAAAGAATATTTAAAATAATTTGTAAATAAAATGTGTTTGTA Mekjian KR, et al. (1999): PE RG
yknT yknT 1495383..1495430 -42:+6 AGAGGAATAGCTGTTCAGTATTTGCATATTGTAGTGTTAACATCATGA Henriques AO, et al. (1997): PE HM OV DB RG
ykvI ykvI 1438012..1438054 -34:+9 TTCGTCTTTTCAAGGAACTTGTCTCATAGGTTATAAAAAGGCA Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
ykvUV ykvU 1449186..1449232 -39:+8 AATAAAATAATTTTTGAACTTGTCTCATATGATGTTGGTAGTACAAG Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
ylbJ ylbJ 1571893..1571940 -39:+9 TATGGTCTAAACTGAACCCCTATGCTCGTATATTAGTACAAAGAATCA Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
gerR ylbO ND ND ND Juan Wu L, et al. (2000): RG DB
Feucht A, et al. (2003): AR DB RG
yloB yloB ND ND ND Feucht A, et al. (2003): AR DB RG
Raeymaekers L, et al. (2002): Western blotting
yncD yncD ND ND ND Feucht A, et al. (2003): AR DB RG
yndA yndA ND ND ND Feucht A, et al. (2003): AR DB RG
yngJIHGFE yngJ 1957373..1957421 -38:+11 CAGGGAATGATTATAGAACTCGCCTAATAGGATGTTACAAAGATGTGAA Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
yoaW yoaW 2047675..2047717 -39:+4 GCCTGAATATTTCTTTGAGCTAATGAATACAATAAATCGATAG Rather PN, et al. (1986): S1 RO
ypjB ypjB 2362353..2362399 -39:+8 GTTGGTCTATCCTTGTCCCTTTCTTCATATTCTGTAAGGAGAGAGAG Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
ypqA ypqA 2337521..2337569 -37:+12 TTTATAACAACATCTGGCATAGACGCATAATCTGGTTAAAAAAGGCGGT Eichenberger P, et al. (2004): Race-PCR
yqfCD yqfC 2616955..2617006 -40:+12 AAAGTGTTAGAACCTCCTTTCAAATCATACATATGAGATGAAAGGGGGTTCT Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
yqfZY yqfZ 2588636..2588685 -38:+12 TTTGTCATGAATCGAAATGGACAAGCATACTATGGTATAAAATTTCGTAT Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
yrrRS yrrR ND ND ND Wei Y, et al. (2004): RG DB
ysnD ysnD ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yteV yteV 3078589..3078632 -37:+7 TCTATCATAACGCTGTTCCAAACGGAATAGATTGATAGAGAAAG Henriques AO, et al. (1997): PE HM OV DB RG
ytrHI ytrH 2994702..2994748 -35:+12 ATCATCATACTTGTCCTGAAAGCTCAATATGATATAAAAGGTGAGGT Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
ytvI ytvI 2983093..2983139 -33:+14 GTATTCATATTCAGCCGCAGCGTGAATACATATAAAAAATAGGACAT Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
ytxC ytxC 2962447..2962493 -39:+8 TTACGTCTATTTTAAAAACATCCCCCATATACTTGTAACAGATGCCG Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
yunB yunB 3323235..3323283 -38:+11 CTATTACTATGTCCCCTCTTACAAGCATACATTGTGATATGTAAGGGGG Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
yuzC yuzC 3257629..3257678 -37:+13 TTTGTCATATTCGGCAATTAGGGATCTATACATATAGAAACATCCTTTTT Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
Kuwana R, et al. (2002): SDS-PAGE, RG
ctpB yvjB ND ND ND Pan Q, et al. (2003): RG DB, gfp assay
ywdL ywdL 3893279..3893331 -46:+7 GTTCTTTTTCAGCATAATCCAAGCATCAGCCTCATAAGGTGAAAGAGATAAAA Ragkousi K, et al. (2003): PE RG
yxjC-scoAB-yxjF yxjC 4004204..4004245 -36:+6 ATCGGAATAGTTGGCCCACGCTTCTCGTACATATGGAAAGGG Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
yyaD yyaD 4204471..4204515 -39:+6 TATGGCATGTTTGCTTTCCTTTATTTATATAGTAACAATAACGGG Eichenberger P, et al. (2003): AR, 5'-RACE-PCR
yybHI yybI 4177708..4177753 -37:+9 TATGTCTTTGATGTGCCATTCCTGCATATAATGATTCATTCAGCTG Eichenberger P, et al. (2003): AR, 5'-RACE-PCR




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai