Transcription factor: SigF

Factor type ND
SWISS-PROT ND
SubtiList ND
Consensus seq. (C/T)G(C/T)(A/T)TA(-35), GG(A/C)A(A/T)A(A/C)TA(-10)
Comment RNA polymerase sporulation-specific sigma factor. Synthesized shortly after the onset of sporulation but do not become active until after polar division; transcription reduced, and probably activation impeded, in hyperosmotic conditions; moving this gene in the 30% region of the chromosome trapped in the forespore during a short interval is sufficient to produce spores in the absence of SpoIIA and SpoIIE.
Link to Phylogenetic profile, Weight matrix, Motif alignment & Similar conserved hexameric motifs

Operon Regulated Gene Absolute position Location Binding seq.(cis-element) Experimental evidence
csbX-bofC bofC 2837442..2837488 -42:+5 ATAAAACGGTTAAGCAGTAGCCTCTTTGGTCAAACTAATCATAAACG Gomez M & Cutting SM (1997): PE NB
csfB csfB ND ND ND Decatur A & Losick R (1996): RG
csfC csfC 3777836..3777906 -58:+13 AAACTTTATTTGTCATTTACGTATTCTTTTTTGCTATTTTGCGCATAATGATGATAATACACAAAAAATAA Decatur A & Losick R (1996): RG
Rong S, et al. (1986): dinucleotide priming
dacF-spoIIAAB-sigF dacF 2446286..2446325 -37:+3 GGCGTATAAAACCATCACGCTTGGAAAAAATAAAAAGGAT Wu JJ, et al. (1992): NB PE
Schuch R & Piggot PJ (1994): RG
gerAABC gerAA 3390714..3390754 -39:+2 CACAGTATATCATTTTTTTAACAGGAAAAGATAACCTCTAC Feavers IM, et al. (1990): RG PE
gpr gpr 2635633..2635674 -39:+3 TTTAGCATGATTTATTCAGCAAATGGCAACAATATAGGTACT Sussman MD & Setlow P (1991): RG PE DB, in-vitro transcription
katX katX 3964935..3964976 -39:+3 GCTGTTTTAAAATCTTTCCATTCAGGGAATATTGTTACCGTT Bagyan I, et al. (1998): PE RG
Petersohn A, et al. (1999): 2D-PAGE
lonB lonB 2884669..2884717 -41:+8 AAAAACGTTTATTCCCGTCTTCTATGGGAGATACTAGCAATCAGAGGAA Serrano M, et al. (2001): NB PE
rsfA rsfA ND ND ND Juan Wu L, et al. (2000): RG DB OV
spoIIGA-sigE-sigG sigG 1605560..1605612 -40:+13 GCAGTGCATATTTTTCCCACCCAAGGAGATACTTAACGTTGTACAGCAGCTCC Sun DX, et al. (1991): PE RG
spoIIQ spoIIQ 3760541..3760607 -40:+27 AGGTTGTATATATTTTCAGAAAAGTGTTCAGAATGTTGCTGAGGTGATGAAACAATGAGAGAGGAAG Amaya EI & Piggot PJ (2001): PE
Londono-Vallejo JA, et al. (1997): DB
spoIIR spoIIR 3795382..3795422 -39:+2 CACGTTTATCCCAGGCTCTCCTTGTCCATAATAGGGCTAGA Karow ML, et al. (1995): RG
spoIVB spoIVB 2520436..2520477 -39:+3 CAGTTATAAATAAGCCGTCAGAAGGCAAAATTAAATGATGTA Gomez M, et al. (1996): PE DB RG
sspN-tlp sspN 1930210..1930251 -39:+3 GTATTCATGTTTACCCCTCCTTTTGAGAAACCTATCTGTTGA Cabrera-Hernandez A, et al. (1999): PE RG
yfhFED yfhD ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yhcM yhcM ND ND ND Kuwana R, et al. (2002): SDS-PAGE, RG
yhcN yhcN 988958..989016 -40:+19 TTTGCATGCATAATTAAAGCCAGTTAGAAAAACCTATAAGTAAAGTGATAAAGGAGGAA Bagyan I, et al. (1998): PE DB OV RG
yhfM yhfM 1102953..1103010 -39:+19 TTAAGCATGGAAACCCCGATCGCTGGGAAAACTAACAATGTTTGGAGTGATGCAAATG Wang S, et al. (2006): AR, Race-PCR
yhfW yhfW 1115584..1115648 -38:+27 CTATGTATGAAAAGATAGAATATGGAAAAATTAAGAATAAATCTGATTGGAGGTATAACGGCTTG Wang S, et al. (2006): AR, Race-PCR
ylbBC ylbB 1565716..1565762 -39:+8 CTCCTTATAAAAATTACCTTTCCTGACAATCATAGTATGAAAGCGTT Wang S, et al. (2006): AR, Race-PCR
yphA-seaA yphA ND ND ND Decatur A & Losick R (1996): RG
yqhQP yqhQ 2540883..2540942 -50:+10 TTTGGCAGCTGCGAGTAAAATTTGAAAATAACGGGTATAATGCATGTAGAAAAAGCAAGG Wang S, et al. (2006): AR, Race-PCR
yqzG yqzG 2555466..2555521 -36:+20 AAATGCATATCCCATTATTATTTGGTAATAATAAACAAAGAAAGGGTGACAGCATG Wang S, et al. (2006): AR, Race-PCR
yrrRS yrrR 2791438..2791492 -39:+16 ATCTGTTTAGCAGCGAAACACCTCGTCCACAATGTGGGTGAGGTGTTTTTTTATG Wang S, et al. (2006): AR, Race-PCR
ytfIJ ytfI 3019456..3019512 -38:+19 CCGGGTTTATTTTTTTAGGAATTGGCGATAATGCTCCTAGAGGAAGTGAAGAATATG Wang S, et al. (2006): AR, Race-PCR
Kuwana R, et al. (2002): SDS-PAGE, RG
ytkD ytkD 3135534..3135585 -45:+7 GCTAGTCTGCATGCAGAACCTGACGGCGTGCTGGGTTTCCCTTATTTTTTGA Ramirez MI, et al. (2004): PE NB RT-PCR
yuiC yuiC 3299238..3299291 -39:+15 TTTTGAATAATGCTCTCTCCACTTGGGAACAATGATTCGGAGGAGAGGTGAATG Wang S, et al. (2006): AR, Race-PCR
ywhE ywhE 3849749..3849794 -42:+4 TTCTGCGATGTTTAAAAACGATCTTTTTTTCTCATAATAGTAGAAA Pedersen LB, et al. (2000): RG PE
ywnJ ywnJ 3759673..3759712 -34:+6 AACAGTCTTAATGAAGAAAACGTCTATCCTTGTGATGGGC Wang S, et al. (2006): AR, Race-PCR
yyaC yyaC 4204797..4204840 -35:+9 CAAAGCATAAAAAATCATACTGCTGGATATACTGTAAACAACCT Wang S, et al. (2006): AR, Race-PCR




Copyright: Human Genome Center, Inst. Med. Sci., Univ. Tokyo; 1999-2008
Contact: Kenta Nakai